Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872848
Length 756 bp
Fasta Format > whthls10i21
cagcgtctcctctcttctccaccgcccgctaggcacacttcgctttgccg caacagccatcccatccatggccccctcccaagaagtcgctccccctgcc gccgccatcaccaaggacccatccaccaacggcaacggnaacggcaacgg cacagccgcaacagcccccaagaccaagacgcctgcgctgaacgagcgga tcctctcctccatcacccgccgctccgtcgccgcccacccgtggcacgac ctggagatcggccccgacgcgcccacaatcttcaactgcgtggtcgagat ccccaaggggagcaaggtcaagtacgagctggacaagaagacggggctca tcaaggtggaccgcgtggtctactcctccgtcgtctacccgcacaactac ggcttcatcccgcgcaccctcttcgacgactccgaccccatcgacgtcct cgtcatcatgcaggagcccgtcgtcccggggtgcttcctccgtgccaagg ccatcggactcatgcccatgatcgaccagggcgaggccgacgacaagatc atcgccgtctgcgccgatgaccccgagtaccgccacttcaacgacatcaa ggagttgcctccccaccggctcgccgaaatcaggcgattcttcaaagact acaagaagaacgagaacaaggaggtggccgtcaacgacttcntgccgtca gangacgcctacgangncatccagcactccatggatctttatgctactta cattgt
Download
page-top