Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872841
Length 596 bp
Fasta Format > whthls10g19
gataaaatggttcgcatattgtgcaatgattgtggggcagtatcanaggt gcagttccacttaattgcacataagtgccataattgcaagtcgtacaaca cccggcagatttgaagtagtgaagccctggagggattctacattcttcct ggaagttggtgagagtgctccggcagtggagattagttcgtctacgtgat gtttgccgtgaaggcacatcactagacaatttatcagcgtcctctgcagt tagctgccctgcatcgtttctgctagttcaaaaaagtgtgtaacagtttc cgcgcgtccgttcaagccttgcatatttcagcactgggcagactggtaga attgtgctctactcgattggtatcatttcctcaccattggccaggcctgc aacggataggatctcctctccagggagagtgttgtgtgcatgcagcaggc tgtgtggcatagggtttaatggttgcaaaatgtcttgatcaacaatttcc atttcagcgatcaccaagttgggctgtcatttccgggtctacattgttgc tgccttttcgttcagnttattgcatgcttcgtctgttaatgtaaaa
Download
page-top