Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872840
Length 737 bp
Fasta Format > whthls10g15
ctaccatttgttctgaagggccttaacgtcacttttcctggaggcatgaa gaccggtattgttggaagaacaggcagtggtaaatcaacactcatacagg cccttttccgaattgtcgagcctactgtcggtcagatactggtagatggt gttgacatctgcaccatcgggctgcacgatctgagatctagacttagcat cattccacaagatccaacgatgtttgagggaactgtgaggagcaaccttg accctcttaacgagtacaatgacgatcaaatctgggaggccttggataac tgtcagctgggagatgaggtcaggaagaaggagctgaaactcgactcgcc agtgatcgagaacggagagaactggagcgtgggccagcgccagctagtct gtctcggaagagtgattctgaaacggaccaagatactggttctggacgaa gccactgcctcagtggataccgcgacagacaacatgatccagaaaacgct gcgtgagaacttctcggaggcgacggtcatcacgattgcgcatcgaatca cctcggtcctcgacagcgacatggttctgctcctcgacaacggtgtggcc gtggagcatgacacgccggccaagctgctggagaacaagtcgtccctgtt ctcaaagcttgtggcagagtacacgatgagggcgacgcatacatagccta cgagtggatcctccagccgttcttccacgccgttgag
Download
page-top