Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872839
Length 718 bp
Fasta Format > whthls10g13
ctgcaggagcccagtcgatggcgtcatcggaaaccggccgcacgccgtcg caaggcgcggaagccgcctccgcctccccctggcctctccgcaagctcca gagctttgcgccagggttgtggccacagtacaaagcctacgaggatgtgt tagtggagagggctaaagttactatttcggatgcgctagttcttgcgagc gagcatcaagcggaggcaattggatgtgccactgtcgcagggttcatctt gttcagaggccctcggagatttttataccgcaatactctgggtcgtttta aaactgagaaggatttactgaatgatgttgaacaaagtatgatcgaatac aaaacatctattgagagcttgagaaaggattccaaatacaccctggacaa agtagtcattggtgaaagtgatctgcagcgtggccgaactgatttgagat ctactggtaagcaaatccagtccgttataagatctatttacaaagcagaa tcaacagctgcaggtttgatggatcaactaagaattattcctacaagaca gtctcttgaattacgagcagaggtggcttccatggcctctgatttgaaaa acaggagacatgtcctggaagaaagggtgaaccgtatatctgaatatggt gtccgcgtctgaatttcgccatagaaccgctcctgggcccctccatggaa taaactcaattcactaag
Download
page-top