Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872837
Length 769 bp
Fasta Format > whthls10g09
cttgctccagtatctgccctctcctgcctgtagagcatccataacgtgaa gttcacggacaaacatgtctccggtgaaggtgttcgggcacccgatgttg acaaacgtcgcacgggtgctgctcttcctggaggaggtgggcgccgagta cgagctcgtgcccgtcgacttcgtcgccggcgagcacaagaggccccaac acgtccagctaaacccgtttgcgaagatgcctgggttccaagatggcgat ctcgtcctgttcgagtcgcgcgccatcgcgaagtacatcctccacaagta cggggggacagccggcctggacctcctcggagaaaacagcggaatcgaag aattagcaatggtggacgtgtggacggaggtggaggcccagcagtactac ccggccatctcgcccgtggtgttcgagtgcatcatcattcccttcatcat ccctggcggtggcgcggcgccgaaccagaccgtcgtggacgagagcctgg agcggctgaggggtgtgctggggatctacgaggcccggctggagaagagc aggtacttggccggggactccatcagcttcgccgatctgaaccacattcc attcaccttctacttcatgaccaccccgtacgccaaggtgtttgatgagt accccaaggtgaaggcctggtgggagatgctcatggcgagaccggcggtg caaanggtctgcaagcatatgcctaccgagtttaagctacgtgcgcagta ctanatgtttatgtactcc
Download
page-top