Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872835
Length 698 bp
Fasta Format > whthls10g03
tgcagatcttcgtcaagaccctcaccggcaagaccatcaccttggaggtt gagtcatccgacaccattgacaacgtgaaggcgaagatccaggacaagga gggcatccccccggaccagcagcgcctcatctttgccggcaagcagcttg aggacggccgcaccctcgctgactacaacatccagaaggagtccaccctc cacctggtgctccgtctcaggggtggtatgcagatcttcgttaagaccct caccggcaagaccatcacgctcgaggtcgagtcatctgacaccattgaca atgtgaaggcgaagatccaggacaaggagggcatcccaccggaccagcag cgcctcatctttgctggtaagcagctcgaggacggccgcaccctcgctga ctacaacatccagaaggagtccaccctccacctggtgctccgtctccgtg gtggccagtaagtgcctggccatggagctgcttatgtctgtgggctcaca agtcggttgcctttctgtgtcctccgatcggattgtcagtgtgtcctcgt ctggtcttgtgctttgttgctaccgtgctgtggtctagtgttatgtactt atgtttggttgtgtccgtgaactttctgaccgcagcagatttggatgaac tgtgaaatgaatgaataagtgagccctgaacttgtgccaaaaaaaaaa
Download
page-top