Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872833
Length 434 bp
Fasta Format > whthls10e23
aagctgtcatgatgctgtcggcgtggcagggaggagcttatttatttttg gtatttaggccgtttatgatggataattcgtcaacactattaacctgtgc taaaaataaggaggacgtcttgatttacgctttcaagtaaaatgtacccc gcaactcccttccatgggcttaaaggtatcgtcaagagagaatcctcctc ctccccccgcgatgatgcgtcggttcacgccgagttccgaacttgagaaa cctgtggttaagctgtgtaaattatagtttccaccgggtacctttgtata tcatgtatgtatgtaactgaaaagatgtttttttgggtgactgactgatc tgtactgtatatattctgttgtagtatgtaccacctatagcttgcaacac atgtatgcatatcgtatttttatcaaaaaaaaaa
Download
page-top