Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872832
Length 760 bp
Fasta Format > whthls10e21
gagatagatgcatacttggtggcttctccgatcagggaacgggcaatttc aaggatcggtgatgtgattgggacatacaatgaccttcgagatcgaatat tttctaaatacccagatttgttccccgagaaggtgtacaacatggagaac tttagatggtccttcggcattctcttctcacgtctggttcgtttagaatc aatggatggaaaggttgcactagttccttgggcagatatgcttaaccata gccctgaggtagatgcattcctggattatgacaagtcatcgcaaggaata gtcttcaccactgatcgttcgtatcaaccaggtgagcaggtgttcatatc ctatgggaagaaatccagtggtgagctattgctttcctatggttttgtac caaaagagggaacaaatccaaatgattcagttgaattcttggtgtctctt aacaagtctgatgagtgctacaaagagaaattacaagcactaaagaaaca cggtttgtcagagtctgaaagtttccccttgagggtcacagggtggccag ttgagctgatggcttatgccttccttgtagtcagtcctcctgagatgatt caacgctttgaggagatggctgttgctgcatccaataaaggttcatccaa gcctgcacttaattatcccgagctggacgagcaggctcttcagtttatct tggactgctgtgaatctagtataaaaaaatataccaagtacctanagggc gccaagggtt
Download
page-top