Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872831
Length 752 bp
Fasta Format > whthls10e19
ccccccaaactcccaactacccgcttactcctgagttctgagcccggtcg atccccgccgcagccaccgacgccgcctccgtcaactcgcacggggaacc tcgccatggccgccgcgtcgtccgccacctccgtccacgacttcaccgtc aaggatgcaagcggcaaggacgtcgacctcagcgtctacaaggggaaggt tcttctcattgttaacgtcgcatcccagtgtggcttgaccaactccaact acaccgagctgagccagctgtacccgaagtacaaggaccaaggctttgag atcttggctttcccatgcaatcagtttggtgggcaggagcctggcaccaa tgatgagatcgttcagtttgcctgcacccgcttcaaggccgagtacccca ttttcgacaaggttgatgtcaacggcagcaatgtttcccccctgtacaag ttcctgaagtctagcaaaggtggccttttcggcgacagcatcaagtggaa cttctccaagttcttggttgacaaggagggtcacgttgttgaccgctatg ccccgaccacttccccactaagcattgagaaggatatcaagaagctgctt gggagctcttanacccgccgctggctggagcctcgagagaaatcggcact ctgtattctagaaacaagaataatgtcgtgttgaaataaaatctgtaccc agcatttcagangatgcatctgctatattttcagcatcctactctgtact tg
Download
page-top