Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872828
Length 757 bp
Fasta Format > whthls10e07
ccccaccgtgatggcctcgtcggccacctccgtcgctcctttccaggggc tcaagtccaccgccggcctccccgtcagccgccgctccaacggcgctagc ctcggcagcgtcagcaacggtggaaggatcaggtgcatgcaggtgtggcc catcgagggcatcaagaagttcgagaccctgtcctacttgccaccgctca gcacggaggccctccttaagcaggtcgactacctgatccgctccaagtgg gtgccttgcctcgagttcagcaaggttgggttcatcttccgtgagcacaa cgcatcccctgggtactacgatggccggtactggacaatgtggaagctgc ctatgttcggatgcaccgacgccacgcaggtgatcaacgaggtggaggag gtcaagaaggagtaccctgacgcctatgtccgcatcatcggattcgacaa catgcgtcaggtgcagtgcgtcagcttcatcgccttcaagccaccgggct gcgaggagtccggcaaggcctaaacagctcactcacgacaggccatatat aaagtgccattgcagttttgtcaactctgacattgctttgggttttcctt ctccatttatctttcttatttgttcctaagaatatgtgtatgtccatgtt catgtacgaacatggctcgagaaagcatgctcgtatgtgaatgctatcgg tggctatgtatatgcacggacgcataatattatacaatatgtcgactata tacgttt
Download
page-top