Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872826
Length 727 bp
Fasta Format > whthls10c23
ctgccctcagtcagccggagccggattgctcctcccgccatggcgctcct caccgatctcctcaacctcgacctcaccgactccacggagaagatcatcg ccgagtacatatggatcggcggatctggcatggatctcaggagcaaggcc aggaccctccccggcccggtcacggatcccagcaagctgcccaagtggaa ctacgacggctccagcaccggccaggcccccggcgaggacagcgaggtca tcctgtacccacaggccatcttcaaggacccgttcaggaagggcaacaac atccttgtcatgtgcgattgctacaccccagctggagtgccaatccccac caacaagagatacaacgctgccaagatctttagcaaccctgatgttgcca aggaggagccatggtatggtattgagcaggagtacaccctcctacagaag gacatcaactggcctctcggctggcctgttggtggattccctggtcctca gggtccttactactgtagtattggtgctgacaagtcgtttgggcgtgaca tagttgacgctcactacaaggcctgcctctttgccggtgtcaacatcagt ggcatcaatggcgaggtcatgcccggacagtgggagttccaagtcggccc gactgttggcatttctgctggcgaccaagtgtgggtcgctcgctaccttc ttgagaggatcactgagatcgccggag
Download
page-top