Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872824
Length 715 bp
Fasta Format > whthls10c19
tacttcctccagggacatgaagatctcaaaggtactgaggttgaagcaat taaaaagtttaagaaagctcttggactcgatgatgtggatgctgcaaata tgcacctggcgattggtagacgcttatacagagagagactcgatgcattc caaaagttaatttttgtgtcaaatcttgtcttcggagatgcatcagactt catacttccatggaaacatcttttcgggatcacggactatcagatcgata ttgctatgcgggagaatgccaaaagtctatacgcgttagagctcaagtct attggaagaggtcttgacataggcacgctcattgaagtgaggagagtaca acttgcatataaactttttgatgaggttgctgctgacatgttcaaggagc atgcgaagaagttggttcaagaaaacatttcatctgctttatccatattg aagtccaataccagtgcagggaacattcccacagaggtcattaatgaggt gaatagtatccttgcattcaataggttgctaacagttctaagcaagtttc ctcaaggcgagcgatttgcacgtgggcttggacctatctcgttagctgga gattttgatcatgatatgatggttggtgatctaaagatactctatgcggc ctatacaacagaagtactttcagatggacggcttgatgatgagaagcttg gtcccttgaatgagc
Download
page-top