Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872822
Length 666 bp
Fasta Format > whthls10c11
atggtctctacttcgtctctatcaaccgtgttgctcttgtgcctggccat gacggcgtcggcgcagctgtcgccgacgttctaccaaacgacgtgcccga acgctctggccaccatcaaggccgccgtgacggccgccgtgaacaaggag aaccgcatgggcgcgtcactgctccggctgcacttccacgactgcttcgt ccaaggttgtgacgcgtctgttctgctatctggcatggaacaaaacgcta tcccgaacgtgatgtcgctgcgaggcttcgaagtcatcgacagcatcaag gcgcagctggagaccatgtgcaagcagaccgtctcctgcgccgacatcct caccgtcgccgccccagactccgtcgtcgccctgggagggccttcgtgga cagttcctctgggaaggagggactccaccaacgcaaacgaagcggcggcg aacaacgagctacctcccccattcttcgacctcgttaacctcacccagtc cttcggtgacaagggcttcaccgtgaccgacatggtcgccctctccggcg cccacactattgggcaggcgcagtgccagaacttcagggacagactctac aacgagaccaacatcaactccggcttcgcgacgtcgctcaaagccaactg cccccagccgaccggc
Download
page-top