Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872816
Length 322 bp
Fasta Format > whthls10a21
gttcatcttccgtgagcacaacgcatcccctgggtactaccatggccggt actggacaatgtgnaanctgcctatgttcgggtgcnccgacnccacacag gtgatcaacgaggtggaanaggtcaagaangantaccctgacgcgtacgt ccgcatcntcngattcnacnacatgcnccnggtgcantgcgtcnncttcn tcnccttcnanccaccgggctgcnangantccggcnaggcctanncngct cactcnccncggnccacntntnangtgccnttgcngttttgtcnnctctg acnttgctttggnttttccttc
Download
page-top