Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872814
Length 403 bp
Fasta Format > whthls10a13
cgtcctccgccggccttgggcgagccgctccgccccgccgtagggcctca ctgaccggagctcctaccaaccactgcgtgcaagcccataccaccgttgg ccacgtaggctccttgattgaggtggctgattgtttcagatcgtctcgct cacaaaattgcgatcagtttcttgatttgttttgctactgagactgggta gtcaaattcangggattgtgtatattctgttggcctgtctttgaggatgg ctgaagcatgccctgatagtcggcgatgcctacctgcttggatgatgaaa ccctgctcgagtaatgaggtgtcaaagactgancatcggaataagcantc ggcggaatctgataagggatcaggggctctagatcaggctaagcccatca gaa
Download
page-top