Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ241237
Length 293 bp
Fasta Format > rwhe19h18
caccacaattcatgtcacccttgnttgcaccagaacacgcacataacacc cacacacacaagccaggcaagggacagtccanncanagtgcacgcntgcg acaaccagagcacatcaaggctcgaattattccaacctagacagggccta ctgctgcccatcactaccgacacaatgggggtgggtcgggtctccaagng gcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttc tncttggtcgccttggtcttgacgaacgactcgcggctgaaga
Download
page-top