Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ241121
Length 678 bp
Fasta Format > rwhe18o03
ttatttattcntnntacgacaaaaggttcacaccacaattcatgcaccct tgcttgcaccagaacacgcacataacacccacacacacaagccaggcaag ggacagtccacgcagagtgcacgcttgcgacaaccagagcacatcaaggc tcgaattattccaacctagacagggcctactgctgcccatcactaccgac acaatgggggtgggtcgggtctccaagcggcgggagggcttacgggttca ctttcggcgcccacccggcgatcaggttctccttggtcgccttggtcttg acgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggt cagggtttcagggaccttccagcccttgaagtgctccagggcgacctgga ggtggtagagcttcggagccaggctgagatcgacggcggagatgttcgcc ccgttgatgtagggtccatgggccttcaggtgctcttcgagtgcctgcag ctcgtcaacaagtgccttctccgaaccatcgctggcatccttgctcttca agaacgtgacgaaggtggagaagatctttgatcccactgatgcatactca ggaggggtcacaagtgatggagttgggtacttctcctcaatgacttgagt gatcacatcagaatcagcaatccatttg
Download
page-top