Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860161
Length 388 bp
Fasta Format > whsctal10f05
ttacactggccaaaccagagacacgcgaacattttcgttacagtcgacaa caaacttgcagagccttattgaactcaaactcaaaccaacaattcagcta catattgggcgtgcggcagttggtgtgggtcacgccgtcgtcgaggtgta gcacgcagcccttgccgtctgccggcgcgcactcgcagtcgcacccgtcg agctcctggccggggtagttgtcgcaggtgatgtggcctccctggaagca caccacggcgcacggcgccttggccttggcgtccgcgatctccccgaaca ccacgagccctgagaggaggaggacgagggtgacggacagcttcatggcg gaaaccataatgccctcgtgtagcgttgtcttgtcttt
Download
page-top