Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860159
Length 163 bp
Fasta Format > whsctal10f02
gacacagccaaacaacactaacacttgggtataataaatcaggcgaaacc tgtgtgatatgtactgacagaaccggaaaccaattctgctatgttcctcc actcttctctcggccaggctaggcgctagaagaaataaacaaatacaatc tcaggatgctgcg
Download
page-top