Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860156
Length 715 bp
Fasta Format > whsctal10e23
tggggaaggctcggtatcgcctgcgcatgctagtgactgatggaaaccgt aagcacacttgaatcacaataaacatgatgtataagctgtacaacgcaaa acagtggcagtaactcttcactatggggcattttcaggtggaatcgtagt tttgctcactacgcccttgctgaagtagtctgctaccacagaaaagccat ccttcgaaccccttaactgcctgaagaagagatcatgatccctggcattt agttctagcttctgctttgcctccataacagatctgtattcaggtgcaca ttccgggcactccttctcattgtccccaaggcagcgaagatggaacgagt gcatgcacatgaaatggacagcaggaagatctagggtgaaggtgcatgct gtgcacttgcttagttgaaaaacctttgcgtttgtcttgaggtcttctat ctcccttttcatcaattctgtctcttcctggtacttgtcaacagattttc tgtcatcttcgattagctttgattcttgctcaagtttgcgagcaatgtaa tccttaacaactgagagagtcaagcatgggttttttgatagtgtctgtag gacaacaattggaggcaaaacatccgccttctcaacgtaggtcaagacct ctttaacttccttagagcaatcttcccnagctcaccaaaataattcaaca ggtcaccccagagag
Download
page-top