Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860148
Length 768 bp
Fasta Format > whsctal10e13
tagagatattacttggctgtgataggtaaaactaagtttattcagagact tcgctaagtgtttgctcaggcagaaggcttctcccacttgaggggcttca ccacctcccaggtgaagtctgcgccctccctgccgaagtgaccgtatgcc gccgtcttgaggtagcgccccttcccgcccctcttgaggtcaaggttgat gatgatcatgcctggcctgaagtcaaagttctccttgacaatctcgagga tctccttgtcagggatcttgcccgtgccgtatgtgtcaacaaacactgag agtggttcaggcacgccaatagcataagacacctggacgatgcagcggcg ggcgatgccactggcgacaatgctcttcgccgcctgccttgcaacatatg caccactgcggtcaaccttggtcgggtccttgccagagaaagcacctcca ccatgagctccccagccaccataggtgtcaatgatgatcttcctgccagt gagaccagcatcgccgtgaggtccaccaatgacaaagcggccagatgggt tgagatggaagatggtattctcatcaaggtactgctctgggatgacaggc ttaatcacatgctccttcagatcagcagcaatctcatcattggtcactgt ctcatcatgctgggtggagatgagcacagtgtggacacgtatagggacca tagcaccattgtcattgtgatactccacagtcacctgggtcttgccatca ggcctcaaccacgggcag
Download
page-top