Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860134
Length 611 bp
Fasta Format > whsctal10d20
aatcatcaggcaaaaggggagctacaagcctcattcatacacactgggaa aaccagcgaaaaggagcatgcatcgcgatgtgcggctgttctgggtggag acgagagtttctaaggagcggaaggtttcatttattcaaaacatcagagg agcagctgcccttcgaatgtggatttacgcgaggcatgagtaggccagcg ccttctcctccgacagctcctgggcggtggcatccatcttcttcctcgag aactcatcgatcgggagcccttgaacaattgtccattcaccaccactgca cgttactgggaaggagtagataagaccagcaggcacaccgtatgaaccat cagagtacacacccatggaaacaaatgttccctcggcggttcccagaacc cagtcacggatgtgatcacaagctgagctggcagcagagagagcactgga gagcttcctcgctttgatgattgcagcaccacgctgctggacagtggcaa tgaactccccgtttagccattcatcatcttgaacaagttcacgaacaggc ttctctccactggaagtcttcacagtggcgtggttaacatcagggtactg actggacgagt
Download
page-top