Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860132
Length 569 bp
Fasta Format > whsctal10d17
gtagtatcagacatggctgctgctgaactgtagcagcttatttccaagac aacaaggaattacagctggaagtggcaaaagccatttcttataatacctc ccaaagaaatgaacagatagtacaaagttgccatcatatgcagggctgac tcatcaacctttagttcttcacagtggtgacgtgcctcagaagcatctga atcacctctggagagatgtttgctgcctgctgcttgagctgctcaatctt tacgtttgtctcttgctcaaggcgtttgacgtttgcgccagagtcaccgc tggtctcggtgagcttcctctggaaatcagcctccatttgtgcacggtac tcagctatttctctctcagcctcttctttggcttgcctaagcctcgccgt tttagcagccctagcagcatttacaatttgctgagcttcttgctctgcag caagcaattgctggattccactcgggcgcctgcttgagtccatgtttggg ctgacggagagaggcgagacgactcgaatcacgtggaagacgagaaggat ccgtggggaaaagctatcc
Download
page-top