Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860130
Length 766 bp
Fasta Format > whsctal10d15
catctcaagagttttcacgaccacacacacgcaaagcgcaaaaactgcac gctggtgcaattccagccacacacacacgagctcatttgccttattcgcg acaccaacaagaaaagaaaacgccacacagatcagtgatcggaatcggat cccacgatgcgagatcccgcctagcaaatcacggcttcttgggaaccatc tgcgcggcgagcttcttcacggccggcctcgccatgatcctctcccacca ggccttgacgtgcgggtacgagtcgaagagggccgcgtgcggcgtggcca tgaagtagaaggtgtaggggaagtggttgaggtccgcgaagctgacgaag tccccggcgaggtagtcgtgcttggacaggcgcgcctcgtagacctccag caccttcttgagcttctccaggctctcgtccaccaccgtttggttggtcg gcaggccgcgcatgagcgggttgatgaggcactcgtacacgatcggcgag atggccgggttgtaggtgtgcgcgtccacctccgtccatacgtccaccat cgccgcctccttgaggtcgccttccctcagcaggtccacttcgttcttct tgtacttgcggagcacgtacctcgcaattgcgcgtgactcgaagagaagc agatccccatcctggaaggcagggatttggccgaacgggtttctgacgag atgctcggggctcttgtgctccatggccttgaaatcgatgtcgacnacct cgtactcggcgccgac
Download
page-top