Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860123
Length 487 bp
Fasta Format > whsctal10d06
ctaggcaatataggtaacataattgtccgtggtacatcagaatgacagtg tagatgaccttccaaaacataccctgggggactgcccatacacatgtaaa taaaacaaaccgagaaaaaccatacacatatggacaatcacaaaacaagc tagagcatatttaggaccttgcaagcagcacagcactcagtccatgtaca aacgaaagaatgacctataaaattcgcaaaaccaaccaaccaaagccaca ggttgccattcgcacaaagatgaccagcaatggatcatgccaatcaatca atcatgatgagagggataaaaacaagcacatatgattgactgatctcatt ctgcgggagaactggaagcagacacttattcaaaagaggtcggctttccg cttctgcagctcttgcttccaccctggctgctggtagaacgcgtccttgg tgatgccgaagacggtctggaactcgctctctgataa
Download
page-top