Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860117
Length 669 bp
Fasta Format > whsctal10c21
cactcggcggagcaaaaagagaactactcagtaccaaaacattgggaaca agcatagatactaagaactggctcaagcttctgctcaggaaacaagcgct ctagtaaccacccttgagatcgttgacgacgtcgtacgggatgggggtga ccgtctcgatggtggtgccctccaccatgaacccaggcttgggccctgct ggctgcctcttcgtgctgatgacctcgccacgcgccttggcctccgcctt cagcttgtcattgttgagtttcctctggaggaactcctcgttgcacctgg atggctgcacgtgctccacacgcacatggatcctcttcttgatgatcctg ttgccgacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt ccagacgcggccggtgcggccgtggtagaacttgtgcggcatgcccttgt ggacggcgccgttcaccttgacgtcgacgtgctccccgaccttgtaggtg cgcaggtaggtggtgagcgggatgtaccccttcttacggaagggccgcgc gaacaggtcgcgcgtccgcgaccgcagcccgtgccccgccggcatcttcc ccttccttcctcctccttgccttctctccctgcggctgtgcggcggcggc ggcgggcgggggggagtgt
Download
page-top