Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860103
Length 757 bp
Fasta Format > whsctal10c06
agaatgttttggataaacaacactggacagggaaaggcaacacgatgtca cccatttaagcatctccattgctgattgtaggaaaaggtgtgctatcaca tagtagaccatccagctaagtcaagttctctcacaaattgagccggaaaa aaactatgttctctccagggtactagggaggtctctcaactgcagccttg agaaattcacaggcttacatcttgatgttgaaatactcaggatcaaaatg gtgtagcctcacatatccatcctcaccaccactcgaaaagctcctcccat caggattaaatgctaatgcattgataggtccaaaatgtcctttaacacca ccaatctcttcttctaaaatcttgtggaaaaatttggcctcaaatttacc cgcacggcgatctgtcatagtaacattcatagcatcttggccacctccaa taaccacatgatcaagagtaggagatatgtcaacagcattaaccggtcgc tctgtgacatatgtctttatcagggtcagtgttcttgcatcccatagctt ggcagatttatccaaggaacctgtgaggaaatgagaccaatctaaggatt ttgacagtgagctaattgccttctgatgtccaacctccttgtctgactcc ttcagcagctttccggtctcagagtcccagatgcggatggtggcatcctc accggcggtgatgatggtccggttgccgggcccccacacggccctgttaa tcctccc
Download
page-top