Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860097
Length 106 bp
Fasta Format > whsctal10b24
ccacgccagcggcgatatctaaccagntnttatgatanaaccaatcatag gtggaggctttccagtactacataagcttgcacgcgcacacttcntgctg ctggga
Download
page-top