Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860094
Length 555 bp
Fasta Format > whsctal10b17
accagccagaagttcgaagatacaaatggtaacactgcatcaatgtacgg tacagaaacaaagacaggatcaggcaaccgcagacacaaacgagactcaa tgaaggacaccaaagacgagacttgcggacccagagaccgaagcagagct ccatggccaggagctttactggccaccacggagacggagcaccaagtgaa gggtggactccttctgaatgttgtagtccgccagggtgcggccatcctca agctgcttaccagcaaagatcaggcgctgctggtccggggggatgccctc cttgtcctggatcttcgccttcacgttgtcaatggtgtcagatgactcca cctccagggtgatggtcttgcccgtgagggtcttcacaaatatctgcatg ccaccacggagcctgagcaccaagtggagggtggactccttctggatgtt gtaatccgcaagggtgcggccatcctcgagctgcttgccggcaaagatca ggcgctgctggtccggggggatgccctccttgtcctggatcttggccttc acatt
Download
page-top