Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860088
Length 719 bp
Fasta Format > whsctal10b11
ggttcaccgaccatggtctttaaacgataaataagcaacaaaacactcgt cttaatgcattagaagatccaacatactaagagaacatttcaacttttgt gcttctgcccaaccaaaataccagcatccaccacagcccaatcacatgaa caggttcggcctcgtcgccttgtaggtggtcttcagcttcctggttggtg gcctgaccttttggtacacaagggggaacttgatcttggagttgtggaac tgcttggtgttgtctctcttgcatagcttgaagttgacagtcgcggtctt gatgatctgaatgcagggggatctcacacggtggcgagaggccatttcag tgtacatctgctccacggcaccattcagtgtggtgtcacggtactccttg tacatgttgtggtagccggttctgctctggtaacgcagccaaatgccata gttcttgatcgtggttgggttcttctcaaagatctcgttgatggcgagca tctggccgttgctcttcttcaccttcttcagcttcctcaggaaataccag aacttgctcttggcgcgcacctcgttggtcgcccagagcttcatgcggta gatcttcggctgctcatcgccgggcgtcggcagcgcgcgacccaccacct ggtactgatggaacctgaaggccaccatttccgcgagctctgcgaagccc ctagcctaacctaacctaa
Download
page-top