Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860087
Length 817 bp
Fasta Format > whsctal10b10
acacactggacaatacacaaacatagatatagtggtacttgcacttgcac catggagccgccacgtatataggtggcatatcccaagagtactcacgtca cgtctggaaaaaaacatagcttgcaaatacgcaatacatttctagaagaa tgaaccaaacataacccgagactagatgataacggcggcggagtgctccc ggagatcagaagcacttcctgtggacgatagccgggccagactcgtcgta ctcatccttggatatccacatctgttggaaagtgctgagtgaggctagga tggaccctccgatccagacactgtacttcctctcaggtggggcgacaacc ttgatcttcatgctgctcggagcaagcgcggtgatctccttgctcatacg gtcagcgatacctgggaacatagttgtgccaccactgagcacaatgttgc cgtacaggtccttcctgatatccacgtcacacttcatgatggagttgtag gtcgtctcatggattccagaagactccatgccgatcatggatggctggaa gaggacctcagggcacctgaacctctctgcgccaatcgtgatgacctgac catcaggaagctcgtagctcttctcaactgaggagctgttcttggcagtc tccagctcctgttcataatcaagggcaacatacgcaagcttctccttgat gtcccttacaatttcccgctcggctgaggttgtgaaggagtaacctctct cggtgaggatcttcatgagggagtccgtgagatcccgaccagcgagatcc aaacgaaaatggcatga
Download
page-top