Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860084
Length 716 bp
Fasta Format > whsctal10b06
cgggcgggagggcgaattcacagattttacagaagcaaattgacagtgtc gtccacggttttacagctccacgaactcaccacaaactgatcgacccagg aagcaaacttaaacgactcatggtgatggcaaggaaggagacgacgcgat catanatcacacggacggacgggcaggcaggcggcgggcttgcacgcaag caagcangctggctgcgctgagctcgctgctcantantcggtggtgggga gctgctcgtgggtgcgggagatgaagagcagctcgtagatgacgccggcg aggccgccgccgatgagggggccgacccagtacacccactggtaccccca ctcccagctgacganggcggggccnaagganacggcggggttcatggacg cgccggagaangcgccgcccaccaggatgttggcgcccacgatgaagccg atggcgatgggcgcgatggtgcccaggctgcccttcttggggtccacggc cgtggcgtacaccgtgtacaccagcccgaaggtcatcacgatctccagca ccaccgcctcccacgcgccgatgccactcagcccgaaggtgccggtgggg agcccgccggtggagaagcggaggaggaagcatgcggcggtggagcccag cagctgcgcgaatccantaaagcaggccgcggaaganggtgatgttgccg cccacgaaggcgccga
Download
page-top