Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860072
Length 758 bp
Fasta Format > whsctal10a13
cagcaatgcccttccatctgtaaggctacaagagattgactgctgctccc attttagagaaaccaagcagccgcaggttagactaaaatttggacttctc atcatacatatagttttcaaacgaaactgaacacaaattgagctggcaaa atagcttgcttctgataaatctgtgacgctccaccgatgcagcttgactt taattagttccagctgctgagcgccgctgccaggcccgtttgagcatcta ctgcacgacgcagatcttcgaggaagttcatctgatgaggaagcttcatg tgaccttgaccccatgacgatccgccagatccagcgtacatcactggttt atctgctcaaccattgagataacatagttagcaacttagcattattatag gagggcactctgctttgttgtttgagattggcagcattgacatgaggtta aggtagtatagctgaatatgatctttatgagacatctattattcataaaa acgtttgaagtgcacagcagcatgcactatcctagtgacactgataggtc cacatgatcctaagaacatttttgtctttccccttgactgtgccactact gctaccaacacttcagattcacgtgcattctttcttgtcaatgattaaag gctaacaaaattacacattaaaaggccgttagagcatctttgatccttat ttctaaaatttgggtcatacaccaattacttgtgctaagaactccatcca aattcact
Download
page-top