Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860068
Length 469 bp
Fasta Format > whsctal10a08
ggctgcctgatttctgctttgagcgagtgagtgagcgttgctcatccaaa aaagtgacgtaattgtttccttacaaccatgcgtatcatcatcactgtca atcaataccaacaaaatgtgagcgacgggcgtaggtcaagcgttcgtttc catgtatgccgccttattcttattcggtttgacaaagaagacggagcaga aaaagcttcttcgccaggcgtggaaatggtcctcacgcctcggcctccat cttctcgcactcttctctgatggactggaacagcaccgacgacaggtacc tctcgccgaagctcgggaacaccaccactatcagcttccccgcgttctcg ggtctctgggcgacctttatggcagcggccgcggctgccccagacgagat cccgaccagcaatccttcctgaagagccaactgctttgctgtctcaacag cctcatcgcttgatatctc
Download
page-top