Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860064
Length 706 bp
Fasta Format > whsctal10a03
acagctggaaatcttgcattacaacaatctgcatctgtgtatatatatgc tatttacaagcacaggtttcaaatactgtatcatcagtgagttacaaaca gatgccatatccatttctttcaagtagaaatgtcacacaaaaacaggcgc gttaggttccaacttggaatcactctacagttatctgcaagacggtggta agccttggttttctatatctcctcagcagcagcgaggaacatactacact gacagacgagaaggccatgcaagcgccagccagccacggcggcatctgca ggccggtgaaggggaagagtgcgccggcagccacagggatggcaacgatg ttatacgccatggcaaagaagtagttccaccggattcgactgaacgtctt ccttgagaggtcaatcgccgtgatgacgtcttcaaggttattccgcacca gcacatagtctgctgcctcgatggcgatgtcagtccctgcaccgatggcc attccgacgtcggctgctgctagggcaggggaatcattgatcccatctcc aaccattgcaaccacgctcccatccttctggaaagagcggattacgtcgg cttttccggcaggcataacctctgctctcacatcttcaattccaatctcc tttgcaaccgccagtgcagtcctccaattgtcccctgtcaccataactgg ataaat
Download
page-top