Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860063
Length 392 bp
Fasta Format > whsctal10a02
acagccgcatcagcacagctccacgatgcttccatccccatccccctgca tgcatgcatgccaaggttttctcggtctagcaaagcaaagcgaagcagct cgctcagggcaggtcctccttcatgccgcgggcgaactcctgggagtgct ccttggtgacgcagctggcgagcatcctggcgccgtccagcggcagcggc gccttgaggatgacgacggaggcgatgaagtcgttgttcacgagcgggcc ggcgaacatgggcgggccgaagccgtagtccacgtcggagaaccccagct tgctccagtcggagacgtagatggactcgtagtcgaagctcatctggaag gggtcctgccgcgtctcctccttggcgaactggaagaactcc
Download
page-top