Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ860062
Length 702 bp
Fasta Format > whsctal10a01
atgcgtgtttttattcaccaccagtaggattaaaacccatattcccagga gcagcaatccagcctaccccaaaatcctctgcacgaacagcaaacgccca ccacaacccaaaaagaatgaaaacggtactggaagtgtcaccttccttaa aaatctacaaatatctccttaatacatcaaaattagaacttttcaatgct tcagcttctcaagaatgtagcctgtgtggcaattgcagaatggtagagcg aggcgcctaatccgcacgggactggccggcacgggacgagaggatgatgc ccacgatgagaccataaagggcaagtgcttctgcgaaaatgaggataagg atcatgcccacgaacagctttggttgttgcgcattagccctgactccagc atcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccac aggcgagcccggaggagaggtgagcgtagccgtcgaagaggaagtagggc ttggccttggggttgatcccggtgctgatgatgacggcgatgatgaggcc gtagattccgagcactcccgccatgacgacgggcacgatggacttcatga caagctccggccgcatgactcccatggacgccaccccgacgccgctcttg gccgtcccgtaggccgcccccatgcatgagaagacgagggcggcggcggc gc
Download
page-top