Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ240438
Length 564 bp
Fasta Format > rwhe15k18
aacaaaattccaacaangnanctattcttacacatgatttaacacatgaa acattcatgcatatctcataagatccaagctaaacacagagtcttcttca tgggcaataccaaaacaggacaccttaagcgcagcaacagtcaccgataa caagcaactaaaaatgtaaagggttcgggtagtaataacggcagagaccg ccctggcgcggccggccggcctagaagcggagcttggtgaagaaccacct gttcttgccggtcttgaacctctcctcgagcttggccttggcggccttgg cggcgcccaccttcttgtccttggaggtgagggagtcgggcgcgccggag gccacctccttgaggtcgacgtcgagggtatagcgggtgggcatgagatg ggtgaagttgacgagcttgaggaacaccttgacgcgggacttcttggccg tcttcttggccgagtccttgcggatcaccttcttcgggtacttggccagc ccggcgacgaggcagtgcccgtacgggcggtcgcgggtgccctcctcgaa cacgcgcacgatca
Download
page-top