Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ242261
Length 660 bp
Fasta Format > rwhe14l24
agatctattcttacatgatttaacacatgaaacatnatcatatctcataa gatccaagctaaacacagagtcttcttcatgggcaataccaaaacaggac accttaagcgcagcaacagtcaccgataacaagcaactaaaaatgtaaag ggttcgggtagtaataacggcagagaccgccctggcgcggccggccggcc tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacct ctcctcgagcttggccttggcggccttggcggcgcccaccttcttgtcct tggaggtgagggagtcgggcgcgccggaggccacctccttgaggtcgacg tcgagggtatagcgggtgggcatgagatgggtgaagttgacgagcttgag gaacaccttgacgcgggacttcttggccgtcttcttggccgagtccttgc ggatcaccttcttcgggtacttggccagcccggcgacgaggcagtgcccg tacgggcggtcgcgggtgccctcctcgaacacgcgcacgatcaccgcctt cttccccgcgtacctgccctgcagcaggatcaccgccttgccgggcttca ggaacttcaccatcttcgcttccttcctcaagctgcgctgcgccgccgcc ggtgggttgg
Download
page-top