Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208664
Length 665 bp
Fasta Format > wh10d12
attcggcacgaggatccgcccctcgctgccgctgcgtctcgtctccacca ccccacttgcccccggactcaggaggatcgtcggagatgtcggacaccga tgagcaccacttcgagtccaaggccgactccggcgcctccaagacctacc cgcagcaggctggcgccatccgcaagggtggacacatcgtcatcaaggcc cgtccctgcaaggttgttgaggtctccacctccaagactgggaagcatgg tcacgcaaagtgtcactttgttgccattgacatctttaatggaaagaagc ttgaggatatcgttccttcatcccacaactgtgacgtcccccatgttgac cgccaagattatcagctgattgacataactgatgatggatatgtcagcct tctcactgagagtggtaacactaaggatgacctgaagcttcccactgatg atgttctgcttggccagatcaagactggatttgctgatggcaaggacctg atcctgtctgtgatgtccgccatgggtgaagaacagatctgcgctgtgaa ggaaatcggtggtggcaagtaagcagctgtgcgtggttgcctacctgcga tacttggtatctagtgcttctgggtgtttgagatacacatacataggcat caagatatctgttgg
Download
page-top