Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848736
Length 405 bp
Fasta Format > whsctal10d21
cggcagcacgtggtcttcggcgaggtcgtcgagggcatggacgtcgtcaa gaacatcgggaaggtgggctcccgcagcggcacctgctccaagcaagtcg tcatcgccgactgcggccagctctagatccgtccgcccgccggtcgcctg tcgtcgtcgccccgtgtcccgtgtcgtcgatctaaataagagagtcgtgt gtcgtgtcgtgtcttccccttgtccgtccgatgagatctccgtggttggt ttaggagggttttaggtggactcttttggccgctggatctgtgtccggcg gccatggttatcttcctgtgtctgctgctatcttactgtttgaatgagat gaactccgctatgaattatccataatttgtgctcgttggcttcacaaaaa aaaaa
Download
page-top