Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848734
Length 605 bp
Fasta Format > whsctal10d17
ttttcccacggatccttctcgtcttccacgtgattcgagtcgtctcgcct ctctccgtcagcccaaacatggactcaagcaggcgcccgagtggaatcca gcaattgcttgctgcagagcaagaagctcagcaaattgtaaatgctgcta gggctgctaaaacggcgaggcttaggcaagccaaagaagaggctgagaga gaaatagctgagtaccgtgcacaaatggaggctgatttccagaggaagct caccgagaccagcggtgactctggcgcaaacgtcaaacgccttgagcaag agacaaacgtaaagattgagcagctcaagcagcaggcagcaaacatctct ccagaggtgattcagatgcttctgaggcacgtcaccactgtgaagaacta aaggttgatgagtcagccctgcatatgatggcaactttgtactatctgtt catttctttgggaggtattataagaaatggcttttgccacttccagctgt aattccttgttgtcttggaaataagctgctacagttcagcagcagccatg tctgatactacttgctaaacctttggtgattagttcataaattttgtcga tttcc
Download
page-top