Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848731
Length 689 bp
Fasta Format > whsctal10d09
gtctttacatccatggtgtcctaccttcaaaagtgtatggttttacagta gagaaggtgactcctgattgttttgaagtatcagactcaacattgaggaa tccaatcatgtgcatggcttctctatggaatggaggtattcataaactga gggttctagcagaaggtgatgactggggtaccttcttaaaggctgttgct tccttgttctgtgtcaaagtgatgttgcacttccagtttagaacgctgat tggtcttgcgctggcatccttgttcattgtcttcattgtctacgaacaat gtgaggaggggattgacgctttagtagctatggcatctgccaaaatcaaa tgcctagtggacagagttgtaagagatttgccggcggttcgaaatgtgct ggtctcttcgaaggcatcgtatattttacaggtaatgttggccatgactc tttgacgctttgtaggctgcagcatgctcagttcacacactttctggatt tccgctgcagttgtccaagattctcgctccaacaagtttcggtgaagtgt gaagtccagctgactggaattgaggaatgcctgttcatacattggaacat tttgtcaatctgtgtagtgtgtatctaacgttttcattcaagaactccag ctccctgctaagttgtagctcntactcagtacttaagtt
Download
page-top