Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848729
Length 579 bp
Fasta Format > whsctal10d03
gcagcatcgcaccagatccaccggtaggagcgagcaagggagatccacct aacccaccaatggcggccgctgcttcctccagcgcgtggaaggcgaggtg gctccgccccgaggcgtacccgatcttcgcggcgacgggcgtagccgtgg ggatctgcgtcatgcagctggtgcgcaacatcaccaccaaccccgaggtc cgggtgaccaaggagaaccgggcggccggggtgctggacaaccacgacga gggccgccgctacgcgcgccaccccttcaggaggttcatcgacggcaagt ccgccgagatcatgcccggcatcaacagcttcttcaccgacccaccaaag aactagacctggtcgccgtcgccggagacctcttgtccaagccaagagga aggaaggaattcctccgcgagattttttttcccttctgaaggaatacagg aatactgttgttgtttttcctcgaattcaagtatattattcgccatgact aattgtctggctgtacaccattgattgttgtgatcatacacacaaaactc ggcctgaataatccctatatgtcttgagg
Download
page-top