Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848725
Length 114 bp
Fasta Format > whsctal10b19
tgctgactaaatgatacccangcgagctgtaacgtgcagttgattttttg atgtgtatgttccatttgattgtcttgaaaataatacaaaattgtttctg tttcnaaaaaaaaa
Download
page-top