Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848724
Length 598 bp
Fasta Format > whsctal10b17
agatccaggacaaggagggcatccccccggaccagcagcgcctgatcttt gccggcaagcagctcgaggatggccgcacccttgcggattacaacatcca gaaggagtccaccctccacttggtgctcaggctccgtggtggcatgcaga tatttgtgaagaccctcacgggcaagaccatcaccctggaggtggagtca tctgacaccattgacaacgtgaaggcgaagatccaggacaaggagggcat ccccccggaccagcagcgcctgatctttgctggtaagcagcttgaggatg gccgcaccctggcggactacaacattcagaaggagtccacccttcacttg gtgctccgtctccgtggtggccagtaaagctcctggccatggagctctgc ttcggtctctgggtccgcaagtctcgtctttggtgtccttcattgagtct cgtttgtgtctgcggttgcctgatcctgtctttgtttctgtaccgtacat tgatgcagtgttaccatttgtatcttcgaacttctgctggtgtgcagcag ctttggtgaacaatgaataagtgagcctgaattcagttaaaaaaaaaa
Download
page-top