Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848719
Length 586 bp
Fasta Format > whsctal10b07
cacgcccagacatccagggtcattgggacaggaacatttggctgtggaac agttatcgtcgagggagaggatttcattgcagagaatatcacgtttcaga actcagctccccagggatccgggcaagcagtcgcagtccgggtaacagca gataagtgtgccttctatggttgtcggttccttggttggcaggatacatt atatttacattatggaaaacaatacttaaganactgttacattgagggta actgtgacttcatctttggtaactctattgcccttctggaacattgccat atacattgcaaatcancgggatttattactgcccatagtcggaaatcctc ttcagaatcaactggctatgtattcctaaggtgtattattacaggaaacg gagaagctggatatatattcctgggtcggccatgggggccctttgggagg gttgtctttgcgcacacttttatggatcgctgtgttaaggccactgggtg gcataattgggacaaatctgagaatgaaagaaccgcttgcttttatgagt acaggtgctcagggcccggttcccggtcatcaagca
Download
page-top