Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848707
Length 415 bp
Fasta Format > whsctal10o03
cctcatccttatctttgccgaagcccttgccctggtacggcctcatcgtc ggcatcatcctctcctcgcgtgccggccaatcccgtgccgactagaaaca aagcacttgcaagcaaggagcatacgtggtccatcattgtattctgtttg aaagggtttatttcttcttagagacttgtttggcattacgctgtggttct acttctgtgttcatgctcctgaacagatcaaggaacataatgtggtttgg gatcatagggatttccacgcctgccatctgtaattttattctatccggca acgcaaagctacctgtatctactcgtcgtacctagcacctgttgtattta ttgtttggagtaataatcggcgatgagcctcttgggacgtgatgaacgaa taagcaaaaaaaaaa
Download
page-top