Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848703
Length 553 bp
Fasta Format > whsctal10m15
gtttttccatctgagccgtccgagccctccgaatttcccggccagaatgg gggagtccagcgcgcttcagtccatcctctacgaccgcggcgcgcttcgc ctcctcgatcagaggaagctgcccctcgaggaggtctacatcgatgtcaa ggactccgcggatggatggaatgcgatcagagacatggttgttcgtggtg ctcctgccatagccatagcggcagcactatcattggctgtggaagttaat gatcacgatttcactggtacacctgtggaagcagcctcattcgtttccaa gaagttggaataccttgtatccagccggcccacagcagtgaacctgtctg atgctgctacaaagcttcagaacttantgtcaagaacagctgaaacagca aaagatgccaaatctatctttcaggtctttattgaagctgcagaggctat gctagttgatgatgtggccgataataaggcaattggcttgcatggagctg aattccttcaacgccagcttggaagttcgagaaacatctctgttctaacc cat
Download
page-top