Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848699
Length 410 bp
Fasta Format > whsctal10m05
ggggccttatgcacttccagttcaatgtcggtaagaccgaggcctccatg gtcgtctccttcaacagccagaaccccggaatcgtcttcgtgcccctcac gctcttcggctccaacccgcccatcccaacgccggtgctcaccaaggcac tccgggtggaggccggggtcgtggaacttctcaagtccaagttcgccgct gggttttaatttctgggagccttccctgaaatgatcaatatataattcca tatatgcatgctagcaaaatttaataattctcaccagaagacatgtattc aagtttcaggttaatctcgcatgcagttgtaataagattgaataagttag cctcatggtgtagccttcgatcagaaccaatatgaggaattgaatgtact aaaaaaaaaa
Download
page-top